Stem-loop sequence mdm-MIR482b

AccessionMI0023126 (change log)
DescriptionMalus domestica miR482b stem-loop
Gene family MIPF0000403; MIR482
Literature search

5 open access papers mention mdm-MIR482b
(12 sentences)

Stem-loop
          u uu       a    -           aaacu       u  gu 
5' aggaagu g  ggaaugg aggg uaggaaagaag     ucucuug au  u
   ||||||| |  ||||||| |||| |||||||||||     ||||||| ||  c
3' ucuuuua c  ccuuacc uccc auccuuucuuu     agagaac ua  c
          k uu       c    u           aaaau       u  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR482b

Accession MIMAT0026022
Sequence

74 - 

ucuuuccuaucccucccauucc

 - 95

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).