Stem-loop sequence mdm-MIR477a

AccessionMI0023125 (change log)
Previous IDsmdm-MIR477
DescriptionMalus domestica miR477 stem-loop
Literature search

3 open access papers mention mdm-MIR477a
(5 sentences)

Stem-loop
   a         aa       u          caauaugu         -      agu 
5'  cucucccuc  gagcuuc cagcuuaagg        uauaccaag auccuu   u
    |||||||||  ||||||| ||||||||||        ||||||||| ||||||    
3'  gagggggag  cucgagg gucggauuuu        auaugguuu uagggg   u
   a         --       u          --------         a      gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC024949.20: 9404-9508 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR477a
mdm-MIR477aMDC024949.20: 9404-9508 [+]
mdm-MIR477bMDC024949.20: 9572-9668 [+]
Database links

Mature sequence mdm-miR477a

Accession MIMAT0026021
Previous IDsmdm-miR477
Sequence

1 - 

acucucccucaagagcuucuc

 - 21

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).