Stem-loop sequence mdm-MIR477b

AccessionMI0023124 (change log)
DescriptionMalus domestica miR477b stem-loop
Gene family MIPF0000216; MIR477
Literature search

2 open access papers mention mdm-MIR477b
(4 sentences)

Stem-loop
               guugc          u    gg      - - --a   u 
5' caaggcauuuuu     ucacucuccc caag  cuucga c c   aug c
   ||||||||||||     |||||||||| ||||  |||||| | |   ||| a
3' guucugugaaaa     agugagaggg guuc  gaagcu g g   uac g
               --aua          -    -a      c a crg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC024949.20: 9572-9668 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR477b
mdm-MIR477aMDC024949.20: 9404-9508 [+]
mdm-MIR477bMDC024949.20: 9572-9668 [+]
Database links

Mature sequence mdm-miR477b

Accession MIMAT0026020
Sequence

20 - 

acucucccucaagggcuucgac

 - 41

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).