Stem-loop sequence mdm-MIR391

AccessionMI0023123 (change log)
DescriptionMalus domestica miR391 stem-loop
Literature search

4 open access papers mention mdm-MIR391
(4 sentences)

Stem-loop
    g      cg   c                  aca  ca  u     g 
5' g gagguu  cua gcaggagagaugacgccg   gu  ug ucuua u
   | ||||||  ||| ||||||||||||||||||   ||  || |||||  
3' c uuccaa  gau cguccucucuacugcggc   ca  au aggau a
    g      ag   a                  -ag  ag  u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009976.353: 25894-25990 [-]
intergenic
Database links

Mature sequence mdm-miR391

Accession MIMAT0026019
Sequence

12 - 

uacgcaggagagaugacgccg

 - 32

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).