Stem-loop sequence mdm-MIR3627c

AccessionMI0023122 (change log)
DescriptionMalus domestica miR3627c stem-loop
Gene family MIPF0001471; MIR3627
Literature search

4 open access papers mention mdm-MIR3627c
(9 sentences)

Stem-loop
           a  u                 c       -ac   a 
5' ggggauuu ug ucgcaggagagauggca uaauugu   ugc a
   |||||||| || ||||||||||||||||| |||||||   |||  
3' ucucuaaa ac aguguccucucuaccgu guuaaca   gcg u
           a  c                 u       acu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC006958.369: 10898-10986 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR3627c
mdm-MIR3627dMDC006958.369: 10681-10770 [+]
mdm-MIR3627cMDC006958.369: 10898-10986 [+]
Database links

Mature sequence mdm-miR3627c

Accession MIMAT0026018
Sequence

13 - 

ucgcaggagagauggcacua

 - 32

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).