Stem-loop sequence mdm-MIR3627b

AccessionMI0023121 (change log)
DescriptionMalus domestica miR3627b stem-loop
Gene family MIPF0001471; MIR3627
Literature search

4 open access papers mention mdm-MIR3627b
(9 sentences)

Stem-loop
       a   a  u    a            c       gcuac 
5' ggag uuu ug ucgc ggagagauggca uaauugu     a
   |||| ||| || |||| |||||||||||| |||||||     a
3' ucuc aaa ac agug ccuuucuaccgu guuaacg     c
       g   a  c    c            u       aacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC010881.251: 3172-3258 [+]
intergenic
Database links

Mature sequence mdm-miR3627b

Accession MIMAT0026017
Sequence

13 - 

ucgcaggagagauggcacua

 - 32

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).