Stem-loop sequence mdm-MIR3627a

AccessionMI0023120 (change log)
DescriptionMalus domestica miR3627a stem-loop
Gene family MIPF0001471; MIR3627
Literature search

4 open access papers mention mdm-MIR3627a
(9 sentences)

Stem-loop
         --a  u                 c       gcc  a 
5' ggauuu   ug ucgcaggagagauggca uaauugu   ac a
   ||||||   || ||||||||||||||||| |||||||   ||  
3' ucuaga   ac agugucuucucuaccgu guuaaua   ug u
         aaa  c                 u       -ac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC007724.222: 3945-4029 [-]
intergenic
MDC007724.326: 2606-2690 [+]
intergenic
Database links

Mature sequence mdm-miR3627a

Accession MIMAT0026016
Sequence

11 - 

ucgcaggagagauggcacua

 - 30

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).