Stem-loop sequence mdm-MIR408a

AccessionMI0023117 (change log)
DescriptionMalus domestica miR408a stem-loop
Gene family MIPF0000102; MIR408
Literature search

4 open access papers mention mdm-MIR408a
(17 sentences)

Stem-loop
       a     --uuaau   a              a     ga       cu       aaa 
5' ggaa gagag       aag cagggaagagguag gcaug  uggaguu  caagagc   a
   |||| |||||       ||| |||||||||||||| |||||  |||||||  |||||||    
3' ccuu cucuc       uuc gucccuucuccguc cguac  aucucag  guucucg   u
       c     ccuccgu   g              a     uc       -u       aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC006505.260: 3714-3836 [-]
intergenic
Database links

Mature sequence mdm-miR408a

Accession MIMAT0026013
Sequence

84 - 

augcacugccucuucccuggc

 - 104

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).