Stem-loop sequence mdm-MIR399h

AccessionMI0023112 (change log)
DescriptionMalus domestica miR399h stem-loop
Gene family MIPF0000015; MIR399
Literature search

6 open access papers mention mdm-MIR399h
(8 sentences)

Stem-loop
   ca       g      c       u   -    u    uuaca     uuaauu      gaa 
5'   gagcaaa ucuccu uggcaug agc cacu acaa     aaugc      cuggcu   c
     ||||||| |||||| ||||||| ||| |||| ||||     |||||      ||||||   a
3'   cucguuu agagga accguau ucg guga uguu     uuacg      gaccgg   a
   gg       -      a       u   u    -    -uuua     --uucc      ucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC021118.72: 3807-3929 [-]
intergenic
Database links

Mature sequence mdm-miR399h

Accession MIMAT0026008
Sequence

103 - 

ugccaaaggagauuugcucgg

 - 123

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).