Stem-loop sequence mdm-MIR399e

AccessionMI0023109 (change log)
DescriptionMalus domestica miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

7 open access papers mention mdm-MIR399e
(9 sentences)

Stem-loop
   ca       g      c       u   -    u     uuacaaauucu    u -u     a  aa 
5'   gggcaaa ucucuu uggcaug agc cacu acaaa           uaau c  ggcug gc  g
     ||||||| |||||| ||||||| ||| |||| |||||           |||| |  ||||| ||   
3'   cucguuu agagga accguau ucg guga uguuu           auua g  ccgac cg  c
   gg       -      a       u   u    -     ---------uc    c uu     -  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009537.404: 16273-16396 [-]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR399e
mdm-MIR399eMDC009537.404: 16273-16396 [-]
mdm-MIR399bMDC009537.404: 9792-9898 [+]
Database links

Mature sequence mdm-miR399e

Accession MIMAT0026005
Sequence

104 - 

ugccaaaggagauuugcucgg

 - 124

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).