Stem-loop sequence mdm-MIR399b

AccessionMI0023106 (change log)
DescriptionMalus domestica miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

6 open access papers mention mdm-MIR399b
(8 sentences)

Stem-loop
   u    aa   u    a                u --au  ug   cauu    c 
5'  gaau  cag gcaa ucuccuuuggcagaaa g    uc  gug    uacu u
    ||||  ||| |||| |||||||||||||||| |    ||  |||    ||||  
3'  cuua  guc cguu agaggaaaccgucuuu c    ag  cac    auga u
   a    ac   c    a                - guau  gu   cauc    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009537.404: 9792-9898 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR399b
mdm-MIR399bMDC009537.404: 9792-9898 [+]
mdm-MIR399eMDC009537.404: 16273-16396 [-]
Database links

Mature sequence mdm-miR399b

Accession MIMAT0026002
Sequence

80 - 

ugccaaaggagaauugcccug

 - 100

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).