Stem-loop sequence mdm-MIR398c

AccessionMI0023104 (change log)
DescriptionMalus domestica miR398c stem-loop
Gene family MIPF0000107; MIR398
Literature search

5 open access papers mention mdm-MIR398c
(26 sentences)

Stem-loop
   gc        -   u       a           u     au     uau 
5'   gguagagg ggu cugcagg gugaccugaga cacau  ggcgu   g
     |||||||| ||| ||||||| ||||||||||| |||||  |||||    
3'   ccaucucu cca ggcgucc cgcuggacucu gugua  ucgcg   u
   ca        u   u       c           u     gu     uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC015053.133: 10556-10656 [-]
intergenic
Database links

Mature sequence mdm-miR398c

Accession MIMAT0026000
Sequence

63 - 

uguguucucaggucgccccug

 - 83

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).