Stem-loop sequence mdm-MIR398b

AccessionMI0023103 (change log)
DescriptionMalus domestica miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

5 open access papers mention mdm-MIR398b
(36 sentences)

Stem-loop
           -   u  a    a           u     gu   auuua 
5' gguagagg ggu cc cagg gugaccugaga cacau  agc     u
   |||||||| ||| || |||| ||||||||||| |||||  |||     g
3' ccaucucu cca gg gucc cgcuggacucu gugua  ucg     u
           u   u  c    c           u     gu   cguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC014136.296: 3441-3538 [-]
intergenic
Database links

Mature sequence mdm-miR398b

Accession MIMAT0025999
Sequence

62 - 

uguguucucaggucgccccug

 - 82

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).