Stem-loop sequence mdm-MIR397a

AccessionMI0023100 (change log)
DescriptionMalus domestica miR397a stem-loop
Gene family MIPF0000120; MIR397
Literature search

3 open access papers mention mdm-MIR397a
(10 sentences)

Stem-loop
           c    a     gc           --    u  u   uwc  a 
5' agaaacau auug gugca  guugaugaaag  uccg au ccu   ga u
   |||||||| |||| |||||  |||||||||||  |||| || |||   ||  
3' ucuuugua uaac cacgu  cgacugcuuuc  aggc ua gga   cu c
           u    c     gu           aa    -  c   uua  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC000805.395: 32063-32163 [-]
intergenic
Database links

Mature sequence mdm-miR397a

Accession MIMAT0025996
Sequence

11 - 

uugagugcagcguugaugaaa

 - 31

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).