Stem-loop sequence mdm-MIR396g

AccessionMI0023099 (change log)
DescriptionMalus domestica miR396g stem-loop
Gene family MIPF0000047; MIR396
Literature search

8 open access papers mention mdm-MIR396g
(37 sentences)

Stem-loop
         c    r a    c                   -gca   --    -        aaac 
5' gauccu cuug g uuuu cacggcuuucuugaacugu    gug  ugca gaagaguu    u
   |||||| |||| | |||| |||||||||||||||||||    |||  |||| ||||||||    g
3' uuagga ggac c aaaa gugucgaaagaacuugaca    cau  acgu cuuuuuaa    g
         c    a c    a                   aaua   ug    a        agac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR396g

Accession MIMAT0025995
Sequence

17 - 

uuccacggcuuucuugaacug

 - 37

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).