Stem-loop sequence mdm-MIR396f

AccessionMI0023098 (change log)
DescriptionMalus domestica miR396f stem-loop
Gene family MIPF0000047; MIR396
Literature search

8 open access papers mention mdm-MIR396f
(38 sentences)

Stem-loop
      c   u  agau      c  u  aa    c                   gcaguuuccagaagaauuaaacug 
5' gug aca ac    gauccu cc gu  uuuu cacggcuuucuugaacugu                        g
   ||| ||| ||    |||||| || ||  |||| |||||||||||||||||||                        c
3' uac ugu ug    cuagga gg ca  aaaa gugucgaaagaacuugaca                        a
      u   -  -agu      c  c  cc    a                   aaaacauagacguacuuuuuaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC001261.116: 9150-9302 [+]
intergenic
Database links

Mature sequence mdm-miR396f

Accession MIMAT0025994
Sequence

31 - 

uuccacggcuuucuugaacug

 - 51

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).