Stem-loop sequence mdm-MIR396c

AccessionMI0023095 (change log)
DescriptionMalus domestica miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

8 open access papers mention mdm-MIR396c
(37 sentences)

Stem-loop
   u       c                   a    aauucuc    -    aaaum 
5'  ugccaug uuuuccacagcuuucuuga cuuc       ugcu gucu     u
    ||||||| ||||||||||||||||||| ||||       |||| ||||      
3'  acgguac agagggugucgaaagaacu gaag       acga cagg     c
   a       c                   c    --guacc    u    acuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003523.387: 23887-23993 [+]
intergenic
MDC011181.611: 958-1064 [-]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR396c
mdm-MIR396cMDC003523.387: 23887-23993 [+]
mdm-MIR396aMDC003523.387: 32684-32832 [-]
Database links

Mature sequence mdm-miR396c

Accession MIMAT0025991
Sequence

12 - 

uuccacagcuuucuugaacuu

 - 32

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).