Stem-loop sequence mdm-MIR396b

AccessionMI0023094 (change log)
DescriptionMalus domestica miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

8 open access papers mention mdm-MIR396b
(37 sentences)

Stem-loop
   -gaagauga   u   c       uc            c          -u   -ucuau  cgagaucgaccgaucuuuggag 
5'          uga ccu uuuguau  uuccacagcuuu uugaacugca  cca      gg                      u
            ||| ||| |||||||  |||||||||||| ||||||||||  |||      ||                      g
3'          acu gga agacaua  agggugucgaaa aacuuggcgu  ggu      cc                      a
   cuuaaaaua   c   u       ga            u          uu   ucaauu  ccuuaucucuaugacucagcug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC016069.205: 14552-14719 [-]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR396b
mdm-MIR396bMDC016069.205: 14552-14719 [-]
mdm-MIR396dMDC016069.205: 8556-8658 [+]
Database links

Mature sequence mdm-miR396b

Accession MIMAT0025990
Sequence

26 - 

uuccacagcuuucuugaacug

 - 46

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).