Stem-loop sequence mdm-MIR396a

AccessionMI0023093 (change log)
DescriptionMalus domestica miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

8 open access papers mention mdm-MIR396a
(38 sentences)

Stem-loop
     u   c       uc            c      a   -u   u  augacgagaucgaccgaucuuuggagu 
5' ga ccu uuuguau  uuccacagcuuu uugaac gca  cca gu                           g
   || ||| |||||||  |||||||||||| |||||| |||  ||| ||                            
3' cu gga agacaua  agggugucgaaa aacuug cgu  ggu ca                           a
     c   u       ga            u      g   uu   u  auucuccuuaucucucugacucagcug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003523.387: 32684-32832 [-]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR396a
mdm-MIR396aMDC003523.387: 32684-32832 [-]
mdm-MIR396cMDC003523.387: 23887-23993 [+]
Database links

Mature sequence mdm-miR396a

Accession MIMAT0025989
Sequence

17 - 

uuccacagcuuucuugaacag

 - 37

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).