Stem-loop sequence mdm-MIR395i

AccessionMI0023092 (change log)
DescriptionMalus domestica miR395i stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mdm-MIR395i
(49 sentences)

Stem-loop
            a  aa         ug c       u     --aa    cu u 
5' ucagguguc cc  gaguucccu  a cacuuca uggga    uagu  c u
   ||||||||| ||  |||||||||  | ||||||| |||||    ||||  |  
3' aguuuacgg gg  cucaagggg  u gugaagu auccu    auca  g u
            c  cc         gu u       c     auaa    ac u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003768.152: 37677-37780 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR395i
mdm-MIR395lMDC003768.152: 35976-36111 [-]
mdm-MIR395iMDC003768.152: 37677-37780 [+]
Database links

Mature sequence mdm-miR395i-5p

Accession MIMAT0037471
Sequence

17 - 

guucccuugaccacuucauug

 - 37

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mdm-miR395i-3p

Accession MIMAT0025988
Sequence

70 - 

cugaaguguuugggggaacuc

 - 90

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).
2
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).