Stem-loop sequence mdm-MIR395h

AccessionMI0023091 (change log)
DescriptionMalus domestica miR395h stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mdm-MIR395h
(49 sentences)

Stem-loop
            ac  a         w  c       u     --a     cuau 
5' ucagguguc  ca gaguucccu ga cacuuca uggga   auagu    u
   |||||||||  || ||||||||| || ||||||| |||||   |||||     
3' aguuuacag  gu cucaagggg uu gugaagu auccu   uauca    u
            cu  c         g  u       c     aua     acgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003846.250: 12137-12240 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR395h
mdm-MIR395kMDC003846.250: 8270-8437 [-]
mdm-MIR395gMDC003846.250: 11880-12031 [+]
mdm-MIR395hMDC003846.250: 12137-12240 [+]
mdm-MIR395jMDC003846.250: 12355-12467 [+]
mdm-MIR395dMDC003846.250: 17630-17771 [-]
mdm-MIR395bMDC003846.250: 18712-18848 [+]
Database links

Mature sequence mdm-miR395h

Accession MIMAT0025987
Sequence

70 - 

cugaaguguuugggggaacuc

 - 90

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).