Stem-loop sequence mdm-MIR395g

AccessionMI0023090 (change log)
DescriptionMalus domestica miR395g stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mdm-MIR395g
(49 sentences)

Stem-loop
   gaaaagaauaa g   gcaaugcu         u    a         ug c       u     --a     cu u 
5'            g ucu        aucaggugu acca gaguucccu  a cacuuca uggga   auagu  c u
              | |||        ||||||||| |||| |||||||||  | ||||||| |||||   |||||  |  
3'            c aga        uaguuuacg uggu cucaagggg  u gugaagu auccu   uauca  g u
   -cuauuaaaaa a   -aacauuu         u    c         gu u       c     aaa     au u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003846.250: 11880-12031 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR395g
mdm-MIR395kMDC003846.250: 8270-8437 [-]
mdm-MIR395gMDC003846.250: 11880-12031 [+]
mdm-MIR395hMDC003846.250: 12137-12240 [+]
mdm-MIR395jMDC003846.250: 12355-12467 [+]
mdm-MIR395dMDC003846.250: 17630-17771 [-]
mdm-MIR395bMDC003846.250: 18712-18848 [+]
Database links

Mature sequence mdm-miR395g-5p

Accession MIMAT0037470
Sequence

42 - 

guucccuugaccacuucauug

 - 62

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mdm-miR395g-3p

Accession MIMAT0025986
Sequence

95 - 

cugaaguguuugggggaacuc

 - 115

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).
2
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).