Stem-loop sequence mdm-MIR395d

AccessionMI0023087 (change log)
DescriptionMalus domestica miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mdm-MIR395d
(49 sentences)

Stem-loop
       g   u c  ua         ug c      auugggaggugagagaucaaucguggauaugguuuu 
5' auca gug c cc  gaguucccu  a cacuuc                                    c
   |||| ||| | ||  |||||||||  | ||||||                                     
3' uagu uac g gg  cucaagggg  u gugaag                                    g
       a   u u  uc         gu u      ucauccuuauguauccuccucaccuccuguuaacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003846.250: 17630-17771 [-]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR395d
mdm-MIR395bMDC003846.250: 18712-18848 [+]
mdm-MIR395dMDC003846.250: 17630-17771 [-]
mdm-MIR395jMDC003846.250: 12355-12467 [+]
mdm-MIR395hMDC003846.250: 12137-12240 [+]
mdm-MIR395gMDC003846.250: 11880-12031 [+]
mdm-MIR395kMDC003846.250: 8270-8437 [-]
Database links

Mature sequence mdm-miR395d-5p

Accession MIMAT0037469
Sequence

18 - 

guucccuugaccacuucauug

 - 38

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mdm-miR395d-3p

Accession MIMAT0025983
Sequence

107 - 

cugaaguguuugggggaacuc

 - 127

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).
2
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).