Stem-loop sequence mdm-MIR395c

AccessionMI0023086 (change log)
DescriptionMalus domestica miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mdm-MIR395c
(49 sentences)

Stem-loop
   ga        u c  ua                    u  -    c a    uaa   c    u 
5'   aucaggug c cc  gaguucccccgaacacuuca ua agau g ugca   guu uuug a
     |||||||| | ||  |||||||||||||||||||| || |||| | ||||   ||| |||| u
3'   uaguuuac g gg  cucaaggggguuugugaagu au ucua c acgu   uag aaau a
   -c        u u  gc                    c  c    c -    uag   u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003846.249: 6394-6521 [+]
intergenic
Database links

Mature sequence mdm-miR395c

Accession MIMAT0025982
Sequence

92 - 

cugaaguguuugggggaacuc

 - 112

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).