Stem-loop sequence mdm-MIR395b

AccessionMI0023085 (change log)
DescriptionMalus domestica miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mdm-MIR395b
(49 sentences)

Stem-loop
        c    cc            ug c       u  g    aaucauccmaaaacccuuccacug 
5' aucag uguc  cuggaguuuccc  a cacuuca ug gaug                        a
   ||||| ||||  ||||||||||||  | ||||||| || ||||                        a
3' uaguc acgg  ggccucaagggg  u gugaagu ac cuac                        g
        u    uu            gu u       c  g    guacguacgacguaccuuaaagug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003846.250: 18712-18848 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR395b
mdm-MIR395gMDC003846.250: 11880-12031 [+]
mdm-MIR395hMDC003846.250: 12137-12240 [+]
mdm-MIR395jMDC003846.250: 12355-12467 [+]
mdm-MIR395dMDC003846.250: 17630-17771 [-]
mdm-MIR395bMDC003846.250: 18712-18848 [+]
Database links

Mature sequence mdm-miR395b

Accession MIMAT0025981
Sequence

102 - 

cugaaguguuugggggaacuc

 - 122

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).