Stem-loop sequence mdm-MIR395a

AccessionMI0023084 (change log)
DescriptionMalus domestica miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mdm-MIR395a
(50 sentences)

Stem-loop
     ua                    u    au  auacaua      u 
5' cc  gaguucccccgaauacuuca uagg  cg       aauucu u
   ||  |||||||||||||||||||| ||||  ||       ||||||  
3' gg  cucaaggggguuugugaagu aucu  gc       uuagga g
     gc                    c    cu  ---cacg      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003768.152: 26163-26255 [-]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR395a
mdm-MIR395lMDC003768.152: 35976-36111 [-]
mdm-MIR395aMDC003768.152: 26163-26255 [-]
Database links

Mature sequence mdm-miR395a

Accession MIMAT0025980
Sequence

69 - 

cugaaguguuugggggaacuc

 - 89

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).