Stem-loop sequence mdm-MIR394b

AccessionMI0023083 (change log)
DescriptionMalus domestica miR394b stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention mdm-MIR394b
(13 sentences)

Stem-loop
   gggucucguagcuagcucuguaa     g   --a     u      cg     c uu   u     gu   -      u c           ucuuucuucgaucucuuucucccucuc 
5'                        acgug aug   ucacg ggguuu  caaag g  ucu acaga  ucu uuggca u uguccaccucc                           u
                          ||||| |||   ||||| ||||||  ||||| |  ||| |||||  ||| |||||| | |||||||||||                            
3'                        uguau uau   agugc cccaaa  guuuc c  agg ugucu  aga aaccgu a acggguggagg                           u
   -ccuagcucaugacgcauugcua     a   gug     u      au     u uu   u     ug   c      c u           uagguaauuugguguauguaugugucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC005660.433: 19401-19638 [-]
intergenic
Database links

Mature sequence mdm-miR394b

Accession MIMAT0025979
Sequence

71 - 

uuggcauucuguccaccucc

 - 90

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).