Stem-loop sequence mdm-MIR394a

AccessionMI0023082 (change log)
DescriptionMalus domestica miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention mdm-MIR394a
(13 sentences)

Stem-loop
        u               uuu  u          -      u c           cc  ucucucug  u  c 
5' ucacg ggguuuugcaaagag   cu acagaguucu uuggca u uguccaccucc  cc        ug gu u
   ||||| |||||||||||||||   || |||||||||| |||||| | |||||||||||  ||        || || g
3' agugc cccaaaauguuucuc   gg ugucucgaga aaccgu a acggguggagg  gg        ac cg u
        c               uuc  u          c      c u           ua  ------ua  u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC016924.31: 605-752 [+]
intergenic
Database links

Mature sequence mdm-miR394a

Accession MIMAT0025978
Sequence

38 - 

uuggcauucuguccaccucc

 - 57

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).