Stem-loop sequence mdm-MIR393c

AccessionMI0023081 (change log)
DescriptionMalus domestica miR393c stem-loop
Gene family MIPF0000083; MIR393
Literature search

6 open access papers mention mdm-MIR393c
(31 sentences)

Stem-loop
            u   a            u    ua    au     auguc      c      -   g 
5' gguggaggc ucc aagggaucgcau gauc  auug  cagau     aaacau auccgc aua a
   ||||||||| ||| |||||||||||| ||||  ||||  |||||     |||||| |||||| |||  
3' cuaccuuug agg uucccuagcgua cuag  ugau  gucug     uuugua ugggug uau c
            c   c            -    gc    gu     ---cu      u      g   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC005391.195: 248-378 [+]
intergenic
Database links

Mature sequence mdm-miR393c

Accession MIMAT0025977
Sequence

11 - 

uccaaagggaucgcauugaucu

 - 32

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).