Stem-loop sequence mdm-MIR390e

AccessionMI0023077 (change log)
DescriptionMalus domestica miR390e stem-loop
Gene family MIPF0000101; MIR390
Literature search

5 open access papers mention mdm-MIR390e
(40 sentences)

Stem-loop
       u       u    u          g         c  ucuc    ug 
5' agug ggaagaa cugu aagcucagga ggauagcgc au    gguu  g
   |||| ||||||| |||| |||||||||| ||||||||| ||    ||||   
3' ucau ucuucuu ggua uucggguucu ccuaucgcg ua    ccaa  u
       -       c    c          a         c  ugca    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC000913.252: 3959-4061 [+]
intergenic
Database links

Mature sequence mdm-miR390e

Accession MIMAT0025973
Sequence

19 - 

aagcucaggagggauagcgcc

 - 39

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).