Stem-loop sequence mdm-MIR390d

AccessionMI0023076 (change log)
DescriptionMalus domestica miR390d stem-loop
Gene family MIPF0000101; MIR390
Literature search

5 open access papers mention mdm-MIR390d
(40 sentences)

Stem-loop
          g    u    a          g       gc       auua      auucu   aau 
5' aguaagg agga cugu aagcucagga ggauagc  cagauga    accaag     aac   u
   ||||||| |||| |||| |||||||||| |||||||  |||||||    ||||||     |||    
3' ucauucu ucuu ggua uuugaguccu ccuaucg  gucuacu    ugguuu     uug   a
          -    c    c          a       ra       --ac      ---au   cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR390d

Accession MIMAT0025972
Sequence

19 - 

aagcucaggagggauagcgcc

 - 39

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).