Stem-loop sequence mdm-MIR390c

AccessionMI0023075 (change log)
DescriptionMalus domestica miR390c stem-loop
Gene family MIPF0000101; MIR390
Literature search

5 open access papers mention mdm-MIR390c
(40 sentences)

Stem-loop
          g    u    a          g        c       auua      auucu   aau 
5' aguaagg agga cugu aagcucagga ggauagcg cagauga    accaag     aac   u
   ||||||| |||| |||| |||||||||| |||||||| |||||||    ||||||     |||    
3' ucauucu ucuu ggua uuugaguccu ccuaucgu gucuacu    ugguuu     uug   a
          -    c    c          a        a       --ac      ---au   cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC001220.292: 9552-9679 [+]
intergenic
MDC040938.6: 23327-23454 [-]
intergenic
Database links

Mature sequence mdm-miR390c

Accession MIMAT0025971
Sequence

19 - 

aagcucaggagggauagcgcc

 - 39

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).