Stem-loop sequence mdm-MIR390b

AccessionMI0023074 (change log)
DescriptionMalus domestica miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

5 open access papers mention mdm-MIR390b
(40 sentences)

Stem-loop
        -      u    u          g         c  ucuc    ug 
5' gugug gaagaa cugu aagcucagga ggauagcgc au    gguu  g
   ||||| |||||| |||| |||||||||| ||||||||| ||    ||||   
3' cacau cuucuu ggua uuugaguccu ccuaucgcg ua    ccaa  u
        u      c    c          a         a  uaca    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC018186.206: 2564-2666 [-]
intergenic
Database links

Mature sequence mdm-miR390b

Accession MIMAT0025970
Sequence

18 - 

aagcucaggagggauagcgcc

 - 38

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).