Stem-loop sequence mdm-MIR172k

AccessionMI0023066 (change log)
DescriptionMalus domestica miR172k stem-loop
Gene family MIPF0000035; MIR172
Literature search

14 open access papers mention mdm-MIR172k
(76 sentences)

Stem-loop
        -    uc  g                     aca   agg a             uaucga       aauuguuaccgcaccaauaag 
5' aguca guau  gc ggugcagcaucaucaagauuc   uac   c agggggcuaccuu      ucgagua                     a
   ||||| ||||  || |||||||||||||||||||||   |||   | |||||||||||||      |||||||                     a
3' ucagu caug  cg cuacgucguaguaguucuaag   gug   g uuccuugauggaa      aguucau                     u
        a    gu  a                     --g   -aa c             ------       guuuuccuucaacuuccuuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC029352.33: 3377-3557 [+]
intergenic
Database links

Mature sequence mdm-miR172k

Accession MIMAT0025962
Sequence

145 - 

ggaaucuugaugaugcugcau

 - 165

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).