Stem-loop sequence mdm-MIR172f

AccessionMI0023061 (change log)
DescriptionMalus domestica miR172f stem-loop
Gene family MIPF0000035; MIR172
Literature search

14 open access papers mention mdm-MIR172f
(76 sentences)

Stem-loop
        uugu    g                     a   ----g     -agug          uaau 
5' aguca    uugc ggugcagcaucaucaagauuc caa     ugagu     ugacaugauu    c
   |||||    |||| ||||||||||||||||||||| |||     |||||     ||||||||||     
3' ucagu    aacg cuacgucguaguaguucuaag guu     gcuca     gcuguacuga    g
        cgau    a                     a   gagga     aguua          uuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC024416.57: 17180-17312 [-]
intergenic
Database links

Mature sequence mdm-miR172f

Accession MIMAT0025957
Sequence

98 - 

agaaucuugaugaugcugcau

 - 118

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).