Stem-loop sequence mdm-MIR171n

AccessionMI0023055 (change log)
DescriptionMalus domestica miR171n stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

9 open access papers mention mdm-MIR171n
(40 sentences)

Stem-loop
   ugg                        a   ucu    a 
5'    gauguugguaugguucaaucaaau aaa   cuca a
      |||||||||||||||||||||||| |||   |||| a
3'    cuauaaccgugccgaguuaguuua uuu   gggu u
   aca                        a   ccu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR171n

Accession MIMAT0025951
Sequence

61 - 

uugagccgugccaauaucaca

 - 81

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).