Stem-loop sequence mdm-MIR171m

AccessionMI0023054 (change log)
DescriptionMalus domestica miR171m stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

9 open access papers mention mdm-MIR171m
(40 sentences)

Stem-loop
   ugg        a               a   ucu     a 
5'    gauguugg auggcucaaucaaau aaa   cccaa g
      |||||||| ||||||||||||||| |||   |||||  
3'    cuauaacc ugccgaguuaguuua uuu   ggguu g
   aca        g               a   ucu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR171m

Accession MIMAT0025950
Sequence

62 - 

uugagccgugccaauaucaca

 - 82

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).