Stem-loop sequence mdm-MIR171k

AccessionMI0023052 (change log)
DescriptionMalus domestica miR171k stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

9 open access papers mention mdm-MIR171k
(40 sentences)

Stem-loop
          c          a         c  a  ca       -a  uc 
5' gagaaag gauguuggug gguucaauc ga ga  gauuuac  ca  c
   ||||||| |||||||||| ||||||||| || ||  |||||||  ||  c
3' uucuuuc cuauaaccgc ccgaguuag cu cu  uuaaaug  gu  u
          a          g         a  -  ag       cg  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC002905.342: 5466-5564 [-]
intergenic
Database links

Mature sequence mdm-miR171k

Accession MIMAT0025948
Sequence

74 - 

uugagccgcgccaauaucacu

 - 94

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).