Stem-loop sequence mdm-MIR171j

AccessionMI0023051 (change log)
DescriptionMalus domestica miR171j stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

9 open access papers mention mdm-MIR171j
(40 sentences)

Stem-loop
   agc          a         c  a  ca       a auyc 
5'    gauguuggug gguucaauc ga ga  gauuugc c    c
      |||||||||| ||||||||| || ||  ||||||| |     
3'    cuauaaccgc ccgaguuag cu cu  uuaaaug g    c
   uca          g         a  -  ag       c cccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC023274.72: 10076-10164 [+]
intergenic
Database links

Mature sequence mdm-miR171j

Accession MIMAT0025947
Sequence

69 - 

uugagccgcgccaauaucacu

 - 89

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).