Stem-loop sequence mdm-MIR171i

AccessionMI0023050 (change log)
DescriptionMalus domestica miR171i stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

9 open access papers mention mdm-MIR171i
(40 sentences)

Stem-loop
   u     --    a   u  u             u       aucucugauaauuagcuuaucuucgaucauaaaucgu 
5'  gcaaa  agca aca gg gugauauugguuu ggcucau                                     c
    |||||  |||| ||| || ||||||||||||| |||||||                                     a
3'  cguuu  ucgu ugu uc cacuauaaccaag ccgagua                                     u
   a     cu    a   -  u             -       gaguuucucaugcaucaugaucagaaacaacacguag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC018836.211: 24237-24391 [+]
intergenic
Database links

Mature sequence mdm-miR171i

Accession MIMAT0025946
Sequence

118 - 

ugagccgaaccaauaucacuc

 - 138

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).