Stem-loop sequence mdm-MIR171e

AccessionMI0023046 (change log)
DescriptionMalus domestica miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

9 open access papers mention mdm-MIR171e
(40 sentences)

Stem-loop
   u    u   u    u         c     u  c     --g    a    gcuuacugcugcaucugcaug 
5'  gaaa agu acug gauguuggc cgguu ca ucaga   agga gacu                     u
    |||| ||| |||| ||||||||| ||||| || |||||   |||| ||||                     a
3'  cuuu ucg ugac cuauaaccg gccga gu agucu   uccu cugg                     c
   a    c   -    u         c     -  u     aag    -    uugguguugcaugcaaggaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC015573.110: 10077-10218 [+]
intergenic
Database links

Mature sequence mdm-miR171e

Accession MIMAT0025942
Sequence

108 - 

ugauugagccgcgccaauauc

 - 128

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).