Stem-loop sequence mdm-MIR171c

AccessionMI0023044 (change log)
DescriptionMalus domestica miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

10 open access papers mention mdm-MIR171c
(44 sentences)

Stem-loop
        u         c       c     -ga  aa     cuuacugcauuugcaugua 
5' uacug gauguuggc cgguuca ucaga   ag  gacua                   c
   ||||| ||||||||| ||||||| |||||   ||  |||||                   g
3' gugac cuauaaccg gccgagu agucu   uc  cuggu                   u
        u         c       u     aag  ca     aucuuguugcaugcauaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC013694.297: 5292-5413 [+]
intergenic
Database links

Mature sequence mdm-miR171c

Accession MIMAT0025940
Sequence

96 - 

ugauugagccgcgccaauauc

 - 116

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).