Stem-loop sequence mdm-MIR171b

AccessionMI0023043 (change log)
DescriptionMalus domestica miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

9 open access papers mention mdm-MIR171b
(40 sentences)

Stem-loop
       --             c       u   -       c   uauu g 
5' aaga  agguauugacgcg cucaauu gaa cgcgugg uaa    g a
   ||||  ||||||||||||| ||||||| ||| ||||||| |||    |  
3' uucu  ucuauaacugcgc gaguuag cuu gcguacc auu    c g
       cc             c       u   a       a   ---- a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC000665.236: 903-995 [+]
intergenic
MDC006592.260: 6338-6430 [-]
intergenic
Database links

Mature sequence mdm-miR171b

Accession MIMAT0025939
Sequence

69 - 

uugagccgcgucaauaucucc

 - 89

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).