Stem-loop sequence mdm-MIR169c

AccessionMI0023040 (change log)
DescriptionMalus domestica miR169c stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention mdm-MIR169c
(9 sentences)

Stem-loop
   gc      cu     -   ua      -         g    uu   -         u    u   c -cc     uuu      --a    auau    uuauu 
5'   aggaag  ggagg ccu  caugaa gaaaagagc uugu  ggu agccaagga gacu gcc g   uccga   caugaa   gaau    ggca     u
     ||||||  ||||| |||  |||||| ||||||||| ||||  ||| ||||||||| |||| ||| |   |||||   ||||||   ||||    ||||     a
3'   uucuuc  ccucc gga  guacuu cuuuucucg gaca  cua ucgguuccu cuga cgg c   agguu   guacuu   uuua    cugu     a
   -c      -u     c   uc      u         -    cu   a         -    -   a cua     --u      aua    aaau    cuguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC001494.456: 32568-32767 [-]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR169c
mdm-MIR169fMDC001494.456: 32862-33044 [-]
mdm-MIR169cMDC001494.456: 32568-32767 [-]
Database links

Mature sequence mdm-miR169c

Accession MIMAT0025936
Sequence

45 - 

uagccaaggaugacuugcccg

 - 65

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).