Stem-loop sequence mdm-MIR169b

AccessionMI0023039 (change log)
DescriptionMalus domestica miR169b stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention mdm-MIR169b
(9 sentences)

Stem-loop
           --u   aaa    ga   -      c     ug  a       -a     u     c  -c      ccuaaagaguaaa  gg      a 
5' ggaagaga   guc   caug  aga aggagc uuguu  gu gccaagg  ugauu gccug ag  cucgau             ga  uuuauu c
   ||||||||   |||   ||||  ||| |||||| |||||  || |||||||  ||||| ||||| ||  ||||||             ||  ||||||  
3' ccuucucu   cgg   guac  ucu uucucg aacag  ca cgguucc  acuga cggac uc  gaguug             cu  aaauag a
           cgu   auc    uc   c      -     ug  g       gc     -     -  uu      -aucccaaaaaga  aa      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC011066.417: 15262-15452 [+]
intergenic
Database links

Mature sequence mdm-miR169b

Accession MIMAT0025935
Sequence

40 - 

uagccaaggaugauuugccugc

 - 61

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).