Stem-loop sequence mdm-MIR167i

AccessionMI0023034 (change log)
DescriptionMalus domestica miR167i stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

11 open access papers mention mdm-MIR167i
(186 sentences)

Stem-loop
         -  ug       u            c       u  aac    --w    
5' ucaugc ac  guagcgg ugaagcugccag augaucu au   uccc   acu 
   |||||| ||  ||||||| |||||||||||| ||||||| ||   ||||   || u
3' aguacg ug  cauuguc acuuugacgguc uacuaga ua   aggg   ugc 
         a  gu       c            -       c  -ga    auu    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR167i

Accession MIMAT0025930
Sequence

19 - 

ugaagcugccagcaugaucuua

 - 40

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).