Stem-loop sequence mdm-MIR167d

AccessionMI0023029 (change log)
DescriptionMalus domestica miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

11 open access papers mention mdm-MIR167d
(184 sentences)

Stem-loop
         --a   a      u           g        aaa   c   cuu 
5' ucgugg   cca uagcgg ugaagcugcca caugaucu   cuu ccu   g
   ||||||   ||| |||||| ||||||||||| ||||||||   ||| |||    
3' agcacu   ggu guuguc acuucgauggu guacuaga   gaa gga   g
         agg   a      c           -        cua   a   acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC016665.144: 23201-23305 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR167d
mdm-MIR167eMDC016665.144: 18208-18331 [+]
mdm-MIR167dMDC016665.144: 23201-23305 [+]
Database links

Mature sequence mdm-miR167d

Accession MIMAT0025925
Sequence

19 - 

ugaagcugccagcaugaucua

 - 39

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).