Stem-loop sequence mdm-MIR166h

AccessionMI0023024 (change log)
DescriptionMalus domestica miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention mdm-MIR166h
(35 sentences)

Stem-loop
   u  a        uu      cu   g c c  u   -    -  u        ca          u   ---      auccac 
5'  ug ggggaaug  gucugg  cga g c cu aac uaga uc augaucuu  ucucaauugg gac   aauuuu      c
    || ||||||||  ||||||  ||| | | || ||| |||| || ||||||||  |||||||||| |||   ||||||      a
3'  ac ccccuuac  cggacc  gcu c g ga uug aucu ag uacuagaa  agaguugacc cug   uuaaaa      a
   a  c        uu      ag   g a u  u   c    u  u        --          -   aya      aauucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC012450.276: 5153-5315 [+]
intergenic
Database links

Mature sequence mdm-miR166h

Accession MIMAT0025920
Sequence

139 - 

ucggaccaggcuucauucccc

 - 159

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).