Stem-loop sequence mdm-MIR166g

AccessionMI0023023 (change log)
DescriptionMalus domestica miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention mdm-MIR166g
(36 sentences)

Stem-loop
   u  a        uu      cu   g      uuc        aua   -    gaucaaccguuauauaccuauacauauaucuauau 
5'  ug ggggaaug  gucugg  cga gacacu   cuugaucu   auc ucua                                   a
    || ||||||||  ||||||  ||| ||||||   ||||||||   ||| ||||                                    
3'  ac ccccuuac  cggacc  gcu cuguga   gaauugga   uag agau                                   u
   a  c        uu      ag   g      --u        --c   u    acauacgucuacuauguguguuguauauguuugug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC020946.295: 36550-36724 [+]
intergenic
Database links

Mature sequence mdm-miR166g

Accession MIMAT0025919
Sequence

151 - 

ucggaccaggcuucauucccc

 - 171

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).