Stem-loop sequence mdm-MIR166f

AccessionMI0023022 (change log)
DescriptionMalus domestica miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention mdm-MIR166f
(35 sentences)

Stem-loop
         a        cu             c     ------------       
5' guguug ggggaaug  gucugguucgaga cauuc            cuuuga 
   |||||| ||||||||  ||||||||||||| |||||            ||||| a
3' cacaau ccccuuac  cggaccaggcuuu guaag            gaaacg 
         c        uu             a     cuacaaguacaa       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC001760.86: 7664-7760 [-]
intergenic
Database links

Mature sequence mdm-miR166f

Accession MIMAT0025918
Sequence

70 - 

ucggaccaggcuucauucccc

 - 90

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).